sebastian
Really into this!
Detective Gadget & Moderator
Posts: 512
|
Post by sebastian on Feb 26, 2013 17:34:46 GMT -5
The $30 to view self published paper looks like this: ACAAGATGCCATTGTCCCCCGGCCTCCTGCTGCTGCTGCTCTCCGGGGCCACGGCCACCGCTGCCCTGCC The multi-million dollar project ended up looking like this: And the results are in looking like this: bigfootevidence.blogspot.ca/2013/02/bill-munns-is-this-matilda.htmlMy conclusion is that the original Ketchum paper with the "angel DNA" may not be that far off. Truly out of this world (from a galaxy far far away).
|
|
sebastian
Really into this!
Detective Gadget & Moderator
Posts: 512
|
Post by sebastian on Feb 27, 2013 16:44:12 GMT -5
Wait! I have more news for you!
Okay, the peer review is in, are you ready?
DNA sequences contain: human, dog, cat, and PANDA!
|
|
Richard
Really into this!
Thinking I should be out in the bush ...
Posts: 562
|
Post by Richard on Feb 27, 2013 19:44:22 GMT -5
|
|
Richard
Really into this!
Thinking I should be out in the bush ...
Posts: 562
|
Post by Richard on Feb 27, 2013 20:34:30 GMT -5
|
|
billr
Really into this!
Posts: 856
|
Post by billr on Feb 27, 2013 23:12:07 GMT -5
Thanks for the links and videos guys
|
|
sebastian
Really into this!
Detective Gadget & Moderator
Posts: 512
|
Post by sebastian on Feb 27, 2013 23:50:33 GMT -5
"My chromosome 11 is walking in the forest without me." LOL!
|
|
Richard
Really into this!
Thinking I should be out in the bush ...
Posts: 562
|
Post by Richard on Feb 28, 2013 20:00:12 GMT -5
"My chromosome 11 is walking in the forest without me." LOL! I was having a coffe whilst watching that video - almost had it coming out my nose when he said that! ;D I read the credentials of the authors of the paper - if the credentials are legit, then there a A LOT of very crazy institutions out there that are hiring these yahoos WOW R
|
|